یافته‌های دوره‌ی دکترا

گردآوری نکته‌هایی در زمینه‌ی زیست‌شناسی (تکاملی)

بایگانی برچسب‌ها: کامپیوتر

پیشنهاد‌هایی برای کسانی که در پژوهش خود نیاز به کدنویسی دارند

بیشتر زیست‌شناسانی که کدنویسی میکنند خودشان برنامه‌نویسی را آموخته اند و آموزش اصولی ندیده‌اند. در کدنویسی، برخی نکته‌ها هست که به خوانا شدن و بازبکارگیری کد کمک می‌کند – و برای بسیاری نیز این نکته‌ها آشنا هستند – ولی در این مقاله که به رایگان نیز در دسترس است، فهرستی کامل‌تر و نکته‌هایی غیرمنتظره‌تر را می‌توان پیدا کرد.

بهتر است پیش از ادامه‌ی کدنویسی، چند دقیقه را به خواندن این مقاله بگذرانید.

لینک فایل پی‌دی‌اف مقاله.

Advertisements

پایگاه‌های داده و ابزارهای موجود زیستی

امروزه داده‌های فراوان زیستی، دانش کامپیوتر را بخشی جدا ناشدنی از آزمایش‌های زیست‌شناسی گردانیده است. همچنین، بسیاری از پروژه‌هایی که بر روی ژنوم‌ها انجام شده داده‌های خود را به رایگان روی اینترنت گذاشته اند، که اینها خود می‌توانند سنگ‌بنای پژوهش‌های بسیاری باشند. با این روی، خود این پایگاه‌های داده و ابزار‌ها چندان گسترده شده‌اند که یافتن ابزار مورد نیاز، به ویژه زمانی که برای نخستین بار با موضوعی روبرو می‌شویم، کاری جزئی نیست. سایت ‌BioCatalogue این مشکل را تا میزان بالایی حل کرده است. در این سایت تقریبا همه‌ی ابزار‌های و پایگاه‌های داده که به کار زیست شناسی می‌آیند فهرست و طبقه‌بندی شده‌اند. سایت دیگری که ابزار‌های زیستی را فهرست کرده است ExPASy است.

طراحی پرایمر

در اینجا به همه‌ی اصول و مراحل طراحی پرایمر برای PCR نمی‌پردازم، چرا که آنها را می‌توان از جاهای دیگر هم به آسانی پیدا کرد. ولی می خواهم چند تا نکته‌ای که پیدا کردنش کمی برای خودم زمان برد و به نظرم دانستنش طراحی پرایمر را ساده تر می‌کند بگویم. من برای طراحی پرایمر، از نرم افزار ApE (که در اینجا درباره‌اش نوشته‌ام) برای دریافت دمای ذوب (Tm) و درصد GC پرامر استفاده میکنم. دریافت این اطلاعات از این نرم افزار بسیار ساده است و تنها بسنده است که توالی خود را با موس انتخاب کنید تا این اطلاعات را به شما نشان بدهد. البته این دست اطلاعات ساده را از بسیاری نرم‌افزارها می‌توانید به دست بیاورید. همچنین، پس از اینکه پرایمر را طراحی کرده اید می‌توانید آن را در نرم افزار Primersearch وارد کنید تا ببینید آیا این پرایمرها کار می‌کنند یا نه. این نرم افزار، پس از وارد کردن توانی ژن مورد نظر و پرایمرها، قطعه ای که تکثیر می‌شود را نشان می‌دهد (درباره‌ی چگونگی کار با primersearch در اینجا توضیح داده ام).

ادامهٔ این نوشته را بخوانید

نرم‌افزار primersearch

این نرم‌افزار برای بررسی کارایی پرایمرهایی است که طراحی شده اند. در این نرم‌افزار، توالی DNA الگو و نیز پرایمرها را وارد می کنیم، و نرم‌افزار به ما می‌گوید که آیا قطعه‌ای به وسیله‌ی PCR تکثیر خواهد شد؟ و اگر آره کدام تکه از DNA است. این نرم‌افزار به صورت آنلاین هست و نیز می توان آن را بارگیری هم کرد. کارکردن با هر دو نوع آن یکسان است. تنها چیزی که باید از آن دانست چگونگی فرمت توالی ها است. توالی DNA الگو را می‌توان کپی پیست کرد یا از یک فایل آن را بارگزاری کرد. این الگو باید با فرمت FASTA باشد. این فرمت با یک < آغاز می شود که جلوی آن نام توالی را می نویسند و سپس از زیر آن خود توالی را می آورند. مانند نمونه‌ی زیر:

sample1<

CATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAAC.CATGAGTGAT

پرایمرها را هم باید در یک فایل متنی (txt) جای داد و بارگزاری کرد. فرمت این فایل باید به این صورت باشد که نخست نام پرایمرها بیاید سپس یک فاصله و توالی پرایمر مستقیم و یک فاصله‌ی دیگر و توالی پرایمر برعکس را بنویسید. مانند نمونه‌ی زیر:

 myprimers GAAATGTGCGCGGAACCC  AGGATCTTCACCTAGATCCT

نرم افزار کار با پلازمیدها

بهترین نرم افزار رایگان کار با پلازمید که شناخته ام: ApE
* Runs in Windows (XP, Vista and 7) and Mac (OS X v10.5 and above)
* Highlights restriction sites in the editing window
* Accurately reflects Dam/Dcm blocking of enzyme sites
* Highlights text using pre-defined and custom feature libraries
* Shows translation, Tm, %GC, ORF of selected DNA in real-time
* Reads DNA Strider, Fasta, Genbank and EMBL files
* Saves files as DNA Strider-compatible or Genbank file format
* Highlights and draws graphic maps using feature annotations from genbank and embl files
* Directly BLASTs selected sequence at NCBI or wormbase
با کاربرد نرم‌افزار Wine بر روی سیستم‌های لینوکس هم نصب می‌شود.

آموزش پرل و یونیکس برای زیست شناسان

Keith Bradnamو  Ian Korf در این سایت کتابچه‌ای را آماده کرده‌اند که از دست‌آورد آموزش پرل و یونیکس به دانشجویان دانشگاه است. این آموزش برای کسانی است که هیچ آشنایی با این دو زبان ندارند و پله پله همراه با تمرین‌هایی این زبان‌ها را برای کاربرد در زیست شناسی یاد می‌دهد. زبان أوزش به انگلیسی است.
http://korflab.ucdavis.edu/Unix_and_Perl/