یافته‌های دوره‌ی دکترا

گردآوری نکته‌هایی در زمینه‌ی زیست‌شناسی (تکاملی)

بایگانی برچسب‌ها: آشناسازی

ابزاری برای پیش‌بینی کارکرد ژن‌ها

GeneMANIA ابزاری آنلاین است که می‌توان به وسیله‌ی آن چند ژن دلخواه را به برنامه داد و همه‌ی ژن‌های مرتبط با آنها را از نظر مسیر عمل، جایگاه‌های پروتئینی مشترک، هم‌بیانی، یا ارتباط ژنتیکی پیدا کرد.

Advertisements

ابزار ارائه پژوهش

مایکروسافت یک افزونه‌ی آزمایشی برای پاورپونت دارد که نمایش محتوا را بسیار دیدنی‌تر و گیراتر می‌کند. با کاربرد این ابزار می‌توانید پاورپوینت‌های غیرخطی درست کنید. برای درک بهتر توانایی آن این ویدپو را ببینید. از اینجا می‌توانید دانلود کنید.

تست انتخاب طبیعی برای هر منطقه از ژنوم انسان

سایتی به تازگی آغاز به کار کرده که به وسیله‌ی آن می‌توان تست‌های انتخاب طبیعی گوناگونی را برای هر منطقه‌ی دلخواه از ژنوم انسان بررسی کرد. این تست‌ها بر پایه‌ی داده‌های پروژه‌ی ۱۰۰۰ ژنوم است و برای جمعیت‌های آفریقایی، آسیایی و اروپایی موجود است.

به این سایت بروید.

پایگاه‌های داده و ابزارهای موجود زیستی

امروزه داده‌های فراوان زیستی، دانش کامپیوتر را بخشی جدا ناشدنی از آزمایش‌های زیست‌شناسی گردانیده است. همچنین، بسیاری از پروژه‌هایی که بر روی ژنوم‌ها انجام شده داده‌های خود را به رایگان روی اینترنت گذاشته اند، که اینها خود می‌توانند سنگ‌بنای پژوهش‌های بسیاری باشند. با این روی، خود این پایگاه‌های داده و ابزار‌ها چندان گسترده شده‌اند که یافتن ابزار مورد نیاز، به ویژه زمانی که برای نخستین بار با موضوعی روبرو می‌شویم، کاری جزئی نیست. سایت ‌BioCatalogue این مشکل را تا میزان بالایی حل کرده است. در این سایت تقریبا همه‌ی ابزار‌های و پایگاه‌های داده که به کار زیست شناسی می‌آیند فهرست و طبقه‌بندی شده‌اند. سایت دیگری که ابزار‌های زیستی را فهرست کرده است ExPASy است.

طراحی پرایمر

در اینجا به همه‌ی اصول و مراحل طراحی پرایمر برای PCR نمی‌پردازم، چرا که آنها را می‌توان از جاهای دیگر هم به آسانی پیدا کرد. ولی می خواهم چند تا نکته‌ای که پیدا کردنش کمی برای خودم زمان برد و به نظرم دانستنش طراحی پرایمر را ساده تر می‌کند بگویم. من برای طراحی پرایمر، از نرم افزار ApE (که در اینجا درباره‌اش نوشته‌ام) برای دریافت دمای ذوب (Tm) و درصد GC پرامر استفاده میکنم. دریافت این اطلاعات از این نرم افزار بسیار ساده است و تنها بسنده است که توالی خود را با موس انتخاب کنید تا این اطلاعات را به شما نشان بدهد. البته این دست اطلاعات ساده را از بسیاری نرم‌افزارها می‌توانید به دست بیاورید. همچنین، پس از اینکه پرایمر را طراحی کرده اید می‌توانید آن را در نرم افزار Primersearch وارد کنید تا ببینید آیا این پرایمرها کار می‌کنند یا نه. این نرم افزار، پس از وارد کردن توانی ژن مورد نظر و پرایمرها، قطعه ای که تکثیر می‌شود را نشان می‌دهد (درباره‌ی چگونگی کار با primersearch در اینجا توضیح داده ام).

ادامهٔ این نوشته را بخوانید

نرم‌افزار primersearch

این نرم‌افزار برای بررسی کارایی پرایمرهایی است که طراحی شده اند. در این نرم‌افزار، توالی DNA الگو و نیز پرایمرها را وارد می کنیم، و نرم‌افزار به ما می‌گوید که آیا قطعه‌ای به وسیله‌ی PCR تکثیر خواهد شد؟ و اگر آره کدام تکه از DNA است. این نرم‌افزار به صورت آنلاین هست و نیز می توان آن را بارگیری هم کرد. کارکردن با هر دو نوع آن یکسان است. تنها چیزی که باید از آن دانست چگونگی فرمت توالی ها است. توالی DNA الگو را می‌توان کپی پیست کرد یا از یک فایل آن را بارگزاری کرد. این الگو باید با فرمت FASTA باشد. این فرمت با یک < آغاز می شود که جلوی آن نام توالی را می نویسند و سپس از زیر آن خود توالی را می آورند. مانند نمونه‌ی زیر:

sample1<

CATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAAC.CATGAGTGAT

پرایمرها را هم باید در یک فایل متنی (txt) جای داد و بارگزاری کرد. فرمت این فایل باید به این صورت باشد که نخست نام پرایمرها بیاید سپس یک فاصله و توالی پرایمر مستقیم و یک فاصله‌ی دیگر و توالی پرایمر برعکس را بنویسید. مانند نمونه‌ی زیر:

 myprimers GAAATGTGCGCGGAACCC  AGGATCTTCACCTAGATCCT

به اشتراک‌گذاری ایده‌های پژوهشی

هر کسی که در زمینه‌ای پژوهشی کار می‌کند، بسیار پیش می‌آید که ایده‌ای به ذهنش می‌رسد که نیازمند بررسی‌های دقیق‌تر است. یا ایده‌هایی هستند که تنها به دلیل نبود بودجه یا زمان، از دنیای ذهن بیرون نمی‌آیند. اگر هدف پژوهشگران گسترش دانش باشد، بسیار پسندیده است که این ایده‌ها را با همگان تقسیم کنند شاید که کسی بتواند آنها را گسترش دهد و به کار بیاندازد.

ماری و توبا، پس از گفتگویی برای واقعیت بخشیدن به امکان به اشتراک گزاری ایده‌ها، سایتی را درست کرده‌اند. این سایت هنوز جوان است و محتوای چندانی ندارد. ولی شاید از همین محتوای اندکش کسی بتواند سود ببرد، و اگر خود ایده‌ای دارید به پربارتر شدن آن کمک کنید

http://ideabasket.org/